Diễn Đàn Sinh Học
Chào mừng bạn đến với Diễn Đàn Sinh Học.
Nếu bạn chưa là thành viên thì hãy đăng kí thành viên.

Diễn Đàn Sinh Học

¨*¤-:¦:- -»°«- Diễn Đàn Sinh Học-»°«- -:¦:-¤*¨
Trang ChủIndexGalleryTrợ giúpThành viênĐăng kýĐăng Nhập
Đăng Nhập
Tên truy cập:
Mật khẩu:
Đăng nhập tự động mỗi khi truy cập: 
:: Quên mật khẩu
Page Views
Counter Powered by RedCounter
Free Penguin Spin MySpace Cursors at www.totallyfreecursors.com
Hỗ trợ trực tuyến
Top posters
TrungMY (1604)
perua_13 (912)
yucute_iu (530)
kieukhachuy (452)
sasuke (394)
Tràng Giang (375)
nhock11b7 (360)
poxynh (326)
bds168 (310)
nh0kl0v3p3kut3 (302)
Trang Liên Kết

  • 12/6 NĐC

  • A1 LQĐ


    April 2017

    Share | 


    Xem chủ đề cũ hơn Xem chủ đề mới hơn Go down 
    Tác giảThông điệp
    Bạch Ngọc Phi Long
    Hành Tẩu Giang Hồ
    Hành Tẩu Giang Hồ

    Xuất thân : Thanh Long Hoa Sơn
    Tuổi : 24
    Nhập môn : 26/12/2008
    Cống hiến : 100

    Bài gửiTiêu đề: CÁC PHƯƠNG PHÁP PHÁT HIỆN VIRUS GÂY BỆNH CHO LAN   Sat Jan 03, 2009 3:29 pm

    Các phương pháp phát hiện virus gây bệnh cho lan </[/font]STRONG><BR><BR><BR><BR></FONT></FONT><FONT color=green>Đối với các nhà vườn lan thì việc khó khăn nhất và nguy hại nhất là sự gây hại nghiêm trọng của các tác nhân gây bệnh cho cây lan, gồm có côn trùng, nấm, vi khuẩn, virus. Trong đó, mức độ tác hại do virus gây ra là nghiêm trọng nhất vì không phát hiện sớm ở giai đoạn đầu và mức độ lây lan cao. Trong đó hai loại virus chính gây hại nghiêm trọng cho lan là virus CymMV (Cymbidium mosaic virus) và ORSV (Odontoglossum ringspot virus). Do vậy, việc phát hiện sớm để ngăn ngừa và kiểm soát virus gây nhiễm là vấn đề then chốt đặt ra cho các nhà nông cũng như là các nhà nghiên cứu nuôi trồng lan. Mà đặc biệt là làm sao có thể dể dàng phát hiện và chẩn đoán sớm 2 loại virus này bằng các kỹ thuật thật đơn giản, ít tốn kém và đầu tư là điều bận tâm rất lớn của các nhà nông. <BR><BR></FONT><BR>&lt;<FONT color=orange> meta http-equiv="Content-Type" content="text/html; charset=utf-8"&gt;&lt; meta name="ProgId" content="Word.Document"&gt;&lt; meta name="Generator" content="Microsoft Word 12"&gt;&lt; meta name="Originator" content="Microsoft Word 12"&gt;&lt; object classid="clsid:38481807-CA0E-42D2-BF39-B33AF135CC4D" id=ieooui&gt;&lt; /object&gt; <BR><BR>Cũng đã có rất nhiều nghiên cứu tìm phương pháp tối ưu nhất để phát hiện 2 loại virus này, bao gồm các phương pháp miễn dịch như ELISA, RIPA (rapid immunofilter paper assay) [3]; phương pháp PCR; các test nhanh; phương pháp sắc ký; … Hiện nay, cũng có nhiều sản phẩm đang lưu hành trên thị trường dung để phát hiện 2 loại virus này như kit DAS-ELISA của hãng DSMZ (D-0187, D-0493, D-0100) [8], các test thử nhanh của Agdia [6], các kit Monoplex, Multiplex RT-PCR,…<BR><BR><BR></FONT><BR><FONT color=darkred>I. PHÁT HIỆN VIRUS GÂY HẠI LAN BẰNG CÁC TEST THỬ NHANH<BR></FONT><BR><FONT color=darkblue>Các loại test thử nhanh này dùng để sàng lọc và phát hiện sớm các mẫu nghi ngờ bị nhiễm bệnh nhằm ngăn ngừa và kiểm soát bệnh hiệu quả. Cách sử dụng các loại test thử này rất đơn giản, nhanh chóng và không cần đầu tư trang thiết bị hiện đại hay kiến thức chuyên sâu như phương pháp chẩn đoán khác ELISA, PCR; chúng rất tiện lợi khi mang theo và thực hiện ở bất cứ nơi nào trong nhà kính hay vườn nuôi mà không cần gửi mẫu đến phòng thí nghiệm; vì vậy chúng rất phù hợp và tiện lợi cho nông dân nuôi trồng lan. Và giá thành so với phương pháp ELISA hay PCR cũng ít hơn rất nhiều.<BR><BR>Về nguyên tắc của các test này là dựa vào phản ứng tạo màu khi có sự hiện diện của 1 kháng nguyên (protein màng bao của virus) kết hợp chuyên biệt với kháng thể tạo phức hợp có màu nhìn thấy được bằng mắt thường.<BR><BR>Hiện nay, trên thị trường thế giới có rất nhiều dạng test kit này của các công ty nổi tiếng, có uy tín; ở đây tôi xin giới thiệu 1 số sản phẩm để tham khảo:<BR><BR></FONT><BR><BR><FONT color=olive>1. Kit Agdia Orchid ImmunoStrip®[6]<BR></FONT><BR><FONT color=yellow>Kit thử nhanh Agdia Orchid ImmunoStrip® của hãng Agdia ([You must be registered and logged in to see this link.] là 1 trong những kít phát hiện nhanh dược sử dụng phổ biến nhất để phát hiện đồng thời 2 loại virus gây bệnh cho thực vật, virus chính gây tác hại nghiêm trọng cho công tác nuôi trồng lan là Cymbidium mosaic virus (CymMV) và Odontoglossum ringspot virus (ORSV). Kit này rất tiện lợi cho việc phát hiện đồng thời cả hai lọai virus trên chỉ trong vòng ít phút. Kết quả được thể hiện rất rõ ràng và cách sử dụng đơn giản, tiện lợi khi dùng bất cứ ở đâu trong vườn hay nhà kính. Chỉ cần cho mẫu nghi ngờ vào túi chuyên dụng đã chứa sẳn dung dịch đệm SEB1 của kít và đặt các que thử (strip) vào trong túi. Kết quả dương tính thể hiện mẫu nhiễm virus khi có sự xuất hiện vạch màu trong vòng 20-30 phút khi so sánh với mẫu đối chứng: kết quả xuất hiện 3 vạch màu là nhiễm cả 2 loại virus; test chỉ xuất hiện 2 vạch chỉ nhiễm 1 loại virus (CymMV hoặc ORSV) và âm tính khi chỉ xuất hiện 1 vạch màu (chi tiết ở hình 1):<BR><BR>&lt;!--[if !vml]--&gt;<BR>&lt;!--[endif]--&gt;<BR><BR>Hình 1: hình minh họa kết quả phát hiện virus CymMV và ORSV bằng kit Agdia ([You must be registered and logged in to see this link.] color=olive>2. Pocket Diagnostics Orchid virus screen - Cymbidium mosaic virus and Odontoglossum ringspot virus [7,9]<BR></FONT><BR><FONT color=indigo>Sản phẩm gồm có 1 pack silica chứa 1 test phát hiện CymMV, 1 test phát hiện ORSV, 1 ống chứa dung dịch tách chiết (extraction bottle), 1 pipett nhựa, vài vòng bi thép sạch,. <BR><BR>&lt;!--[if !vml]--&gt;&lt;!--[endif]--&gt; <BR><BR><BR><BR>&lt;!--[if !vml]--&gt;&lt;!--[endif]--&gt;<BR><BR>Hình 2: các sản phẩm của kit Pocket Diagnostics Orchid virus screen (http://jwund.homestead.com/pdviruskit.html)<BR><BR><BR><BR>Cách thực hiện kit này rất dễ dàng tiện dụng, không cần kinh nghiệm và dể bảo quản (lưu trữ ở nhiệt độ phòng, khô thoáng): <BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Sử dụng mẫu lá mới nhất nghi ngờ nhiễm bệnh.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Cắt các mẫu mô lá này thành những mảnh nhó có kích thước khoảng 5-7mm theo chiều rộng, và chiều dài khoảng 1-2cm, sau đó lát mỏng các mẫu lá này theo chiều dọc. Đối với mẫu hoa, chỉ cần cắt nhó.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Thực hiện 3 vạch cắt chéo ngang mẫu lá đã lát mỏng, và đặt vào trong extraction bottle. <BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Lắc trong vòng 30 giây. Lấy vài giọt mẫu sau khi lắc nhỏ vào giếng tròn của dụng cụ test phát hiện virus.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Trong vòng 3-5 phút kết quả xuất hiện sẽ cho biết mẫu dương tính hay âm tính: kết quả dương tính có 2 vạch màu xuất hiện ở dòng ghi chữ C (đối chứng) và T (virus ORSV hoặc CymMV ), kết quả âm khi chỉ có 1 vạch ở dòng ghi chữ C.<BR><BR><BR><BR><BR>&lt;!--[if !vml]--&gt;<BR><BR><BR>&lt;!--[endif]--&gt;<BR><BR>Hình 3: kết quả phát hiện virus với kit Pocket Diagnostics Orchid virus screen (http://jwund.homestead.com/pdviruskit.html)<BR><BR><BR></FONT><BR><FONT color=darkred>II. PHÁT HIỆN VIRUS GÂY HẠI CHO LAN BẰNG RT-PCR<BR></FONT><BR><FONT color=cyan>Phát hiện virus gây hại bằng RT-PCR là 1 phương pháp có độ tin cậy cao hơn các phương pháp khác. Bằng cách phát hiện sự hiện diện của 1 gene nào đó của virus, cụ thể đối với virus CymMV và ORSV là gene CP (coat protein gene), gene tổng hợp protein màng bao của virus. Tuy nhiên, sử dụng phương pháp này rất tốn kém, đòi hỏi phải có phòng thí nghiệm tân tiến có trang thiết bị hiện đại đầy đủ như máy PCR, bộ điện di, máy chụp gel, các thiết bị chuyên dùng khác và hóa chất rất đắt tiền. Và đòi hỏi người thực hiện phải có trình độ chuyên môn cao.<BR><BR><BR><BR><BR><BR><BR><BR>Qui trình thực hiện bao gồm các bước cơ bản như sau [1]:<BR><BR>Tách chiết RNA:<BR><BR>RNA tổng số được tách chiết từ mô lá của mẫu Lan nghi ngờ và 1 mẫu thực vật làm đối chứng theo hướng dẫn kit tách chiết (ở đây tôi trình bày tóm tắt cách sử dụng của kit Plant Total RNA Extraction Miniprep system; Vio gene, Mỹ):<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;100mg mô lá lan được nghiền ra trong nitơ lỏng.Chuyển vào eppendorf.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Bổ sung 450 µl RX buffer. Trộn đều. <BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Lọc dung dịch qua cột (Shearing tube column).<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Rửa cột với 230 µl ethanol tuyệt đối. Lọc dung dịch qua cột (Plant total RNA tube column) của kit. <BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Rửa cột lần nữa 1 lần với dung dịch WF, và 2 lần với dung dịch WS.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Hòa RNA tổng số trong 50 µl nước cất 2 lần.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Đo nồng độ RNA thu được.<BR><BR>&lt;!--[if !supportLists]--&gt;-&lt;!--[endif]--&gt;Lưu trữ -80oC đến khi dùng.<BR><BR><BR><BR>Trình tự primer: <BR><BR>Cặp primer tổng hợp gene CP của virus CymMV; sản phẩm có kích thước 669bp:<BR><BR>CymMV CP-F1: ATGGGAGAGYCCACTCCARCYCCAGC <BR><BR>CymMV CP-R1 TTCAGTAGGGGGTGCAGGCA.<BR><BR><BR><BR>Cặp primer tổng hợp gene CP của virus ORSV; sản phẩm có kích thước 474bp:<BR><BR>ORSV CP-F1 ATGTCTTACACTATTACAGACCCG.<BR><BR>ORSV CP-R1 GGAAGAGGTCCAAGTAAGTCC.<BR><BR><BR><BR>Cặp primer tổng hợp gene nad5 mRNA của thực vật dùng làm chứng nội; sản phẩm có kích thước 185 bp:<BR><BR>mt-F2 GCTTCTTGGGGCTTCTTGTTCGATA<BR><BR>mt-R1 ATCTCCAGTCACCAACATTGGCAT<BR><BR><BR></FONT><BR><FONT color=green>a. Thực hiện phản ứng Monoplex RT-PCR:<BR></FONT><BR><FONT color=orange>Chuẩn bị phản ứng RT: <BR><BR>Đối với Mẫu phân tích: (Chuẩn bị mẫu đối chứng tương tự ngoại trừ không có sản phẩm RNA của virus sau tách chiết): <BR><BR>- Trộn từng loại 2 µl RNA tổng số (virus và thực vật) (nồng độ khoảng 200ng) đã tách chiết ở trên tương ứng với từng loại 0.5 µl primer ngược (nồng độ 5µM):<BR><BR>&lt;!--[if !supportLists]--&gt;·&lt;!--[endif]--&gt;RNA của virus CymMV: sử dụng primer CymMV CP-R1.<BR><BR>&lt;!--[if !supportLists]--&gt;·&lt;!--[endif]--&gt;RNA của virus ORSV: sử dụng primer ORSV CP-R1.<BR><BR>&lt;!--[if !supportLists]--&gt;·&lt;!--[endif]--&gt;RNA của thực vật: sử dụng primer mt-R1.<BR><BR><BR><BR>Tiếp tục trộn hổn hợp trên với 5 µl nước cất 2 lần. Đun 10 phút ở 70oC, làm lạnh ngay trên đá trong 5 phút. Tiếp tục bổ sung vào hổn hợp RT gồm:<BR><BR><BR><BR>Nước cất 2 lần3.25 µl<BR><BR>Buffer (5x, Promega) 2.5 µl<BR><BR>dNTPs (10mM) 1.25 µl<BR><BR>RNasin (40 U/µl, Promega) 0.25 µl<BR><BR>AMV reverse transcriptase (10 U/l, Promega) 0.25 µl<BR><BR><BR><BR>ủ phản ứng trên ở 42oC trong 60 phút. Tiếp tục bổ sung các hóa chất sau để tiến hành phản ứng PCR: (sử dụng mỗi cặp primer cho từng mẫu RNA tương ứng):<BR><BR>Sản phẩm của phản ứng RT 2 µl<BR><BR>DyNAzyme™ II DNA polymerase buffer (10x, Finnzymes Inc.) 2 µl<BR><BR>1 cặp Primer xuôi và ngược (5µM)2 µl<BR><BR>dNTPs (2 mM) 2 µl<BR><BR>DyNAzyme™ II DNA polymerase enzyme (2 U/ µl, Finnzymes Inc.) 0.4 µl<BR><BR>Nước cất 2 lần 11.6 µl.<BR><BR><BR><BR>Sau khi đã chuẩn bị, tiếp theo là đặt các phản ứng vào máy PCR và thiết lập chương trình phản ứng như sau:<BR><BR><FONT color=red>Bước 1: biến tính ở 96o C trong 5 phút.<BR><BR>Bước 2: 96o C trong 30 giây.<BR><BR>Bước 3: 52o C trong 30 giây.<BR><BR>Bước 4: 72o C trong 30 giây.<BR><BR>Lặp lại 30 chu kỳ từ Bước 2 đến Bước 4.<BR><BR>Bước 5: 72o C trong 7 phút.<BR></FONT><BR><BR><BR>Và cuối cùng là phân tích sản phẩm khuếch đại trên gel agarose, nhuộm gel và quan sát trên máy đọc UV để xác định kích thước các vạch DNA xuất hiện trên gel khi so sánh với thang chuẩn DNA ladder 1kb Plus (Invitrogen). Từ đó suy ra kết quả. <BR><BR><BR><BR><FONT color=green>b. Thực hiện phản ứng Multiplex RT-PCR:<BR><BR></FONT><FONT color=cyan>Chuẩn bị và thực hiện tương tự như Monoplex RT-PCR. Tuy nhiên, có vài điều khác biệt cần lưu ý: <BR><BR><BR><BR>Phản ứng RT:<BR><BR>Được chuẩn bị và thực hiện tương tự như phản ứng Monoplex RT-PCR, ngoại trừ 3 primer ngược (primer reverse CymMV CP-R1, ORSV CP-R1 và mt-R1) là được cho vào đồng thời trong cùng 1 phản ứng. Và nồng độ RNA của virus có thể pha loãng bậc 10 thành nhiều nồng độ (10 ng, 1 ng, 100 pg, 10 pg, 1 pg, 100 fg, 10 fg và 1 fg) để xác định ngưỡng phát hiện của phản ứng Multiplex RT-PCR sau này.<BR><BR><BR><BR><BR><BR><BR><BR><BR><BR><BR><BR><BR><BR>Phản ứng PCR: sử dụng đồng thời 3 cặp primer cho tứng mẫu RNA:<BR><BR>Sản phẩm của phản ứng RT 2 µl<BR><BR>DyNAzyme™ II DNA polymerase buffer (10x, Finnzymes Inc.) 2 µl<BR><BR>3 cặp Primer (5µM) 2 µl<BR><BR>dNTPs (2 mM) 2 µl<BR><BR>DyNAzyme™ II DNA polymerase enzyme (2 U/ µl, Finnzymes Inc.) 0.4 µl<BR><BR>Nước cất 2 lần 11.6 µl.<BR><BR><BR></FONT><BR></FONT><FONT color=blue>Về cơ bản thì qu trình phát hiện virus gây bệnh lan gồm những bước như trên, tuy nhiên có thể thay đổi 1 số thành phần hóa chất từ thực vật hay điều kiện phản ứng để cải tiến tốt hơn như thay đổi thành phần Taq DNA polymerase của hãng Biorad, Roche, Qiagen,.., kit tách chiết RNA của Qiagen…<BR><BR><BR></FONT>

    Được sửa bởi Bạch Ngọc Phi Long ngày Mon Jan 05, 2009 8:03 pm; sửa lần 1.
    Về Đầu Trang Go down
    Minh Chủ Võ Lâm
    Minh Chủ Võ Lâm

    Xuất thân : Hell
    Nghề Nghiệp : Civil Engineer
    Tính cách : Crazy
    Tuổi : 26
    Nhập môn : 23/12/2008
    Cống hiến : 1604

    Cấp Bậc Võ Lâm
    Môn Phái: Thiên Vương Thiên Vương
    Cấp Bậc: Bang Chủ

    Bài gửiTiêu đề: Re: CÁC PHƯƠNG PHÁP PHÁT HIỆN VIRUS GÂY BỆNH CHO LAN   Sat Jan 03, 2009 4:02 pm

    post bai gi ma toan la HTML hok ha ! dai wa ai ma doc cho noi ?!

    Vô Cực sinh Thái Cực - Thái Cực sinh Lưỡng Nghi
    Lưỡng Nghi sinh Tứ Tượng - Tứ Tượng sinh Bát Quái

    YM: tui_la_tui_chu_ai107
    Mail: [You must be registered and logged in to see this link.]
    Phone: 091718 2468 or 0945 291 666
    Về Đầu Trang Go down
    Bang Chủ Môn Phái
    Bang Chủ Môn Phái

    Xuất thân : the gioi ngam
    Nghề Nghiệp : hoc sinh
    Tính cách : binh thuong cung hien , ai choc wao len chui chet cha no lun
    Tuổi : 23
    Nhập môn : 29/12/2008
    Cống hiến : 530

    Cấp Bậc Võ Lâm
    Môn Phái: Nga Mi Nga Mi
    Cấp Bậc: Chưởng Môn

    Bài gửiTiêu đề: Re: CÁC PHƯƠNG PHÁP PHÁT HIỆN VIRUS GÂY BỆNH CHO LAN   Mon Jan 05, 2009 7:18 pm

    doc mun mu` con mak lun da
    Về Đầu Trang Go down
    Sponsored content


    Về Đầu Trang Go down
    Xem chủ đề cũ hơn Xem chủ đề mới hơn Về Đầu Trang 
    Trang 1 trong tổng số 1 trang

    Permissions in this forum:Bạn không có quyền trả lời bài viết
    Diễn Đàn Sinh Học :: GÓC HỌC TẬP :: Sinh :: Vi Sinh Vật Học-
    Chuyển đến